Aprinocarsen

**Semantic type:** Nucleic Acid, Nucleoside, or Nucleotide|Pharmacologic Substance

**Definition:** A synthetic phosphorothioate oligodeoxynucleotide. As an antisense molecule, aprinocarsen hybridizes to the 3-untranslated region of the human protein kinase C (PKC-alpha) mRNA, thereby inhibiting PKC-alpha expression and growth of PKC-alpha-dependent tumor cells. (NCI04)

**Synonyms:** - APRINOCARSEN - Affinitac - Affinitak - CGP 64128A - DNA, d(P-thio)(G-T-T-C-T-C-G-C-T-G-G-T-G-A-G-T-T-T-C-A) - DNA, d(P-thio)(GTTCTCGCTGGTGAGTTTCA) - ISIS 3521 - ISIS 3521 - LY900003 - Protein Kinase C-Alpha Antisense