EGFR NM_005228.3:c.2254_2277del24

**Semantic type:** Cell or Molecular Dysfunction

**Definition:** A deletion of 24 nucleotides from the coding sequence of the EGFR gene from position 2254 through 2277.

**Synonyms:** - EGFR NM_005228.3:c.2254_2277delTCTCCGAAAGCCAACAAGGAAATC - ERBB c.2254_2277del24 - ERBB1 c.2254_2277del24 - Epidermal Growth Factor Receptor Gene c.2254_2277del24 - Epidermal Growth Factor Receptor Gene c.2254_2277del24 EGFR c.2254_2277del24 - HER1 c.2254_2277del24 - NM_005228.3:c.2254_2277del - NM_005228.3:c.2254_2277del24 - NM_005228.3:c.2254_2277delTCTCCGAAAGCCAACAAGGAAATC